View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_143 (Length: 269)
Name: NF3918_low_143
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_143 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 151; Significance: 6e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 151; E-Value: 6e-80
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 39359765 - 39359566
Alignment:
| Q |
1 |
ttaacaattattaatgaatataggaacgagattattgtgttacgtctgcgttcaatgtaattcatctacttgattttgttttttaaaagataatctctaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39359765 |
ttaacaattattaatgaatataggaacgagattattgggttacgtctgcgttcaatgtaattcatctacttgattttgttttttaaaagataatctctaa |
39359666 |
T |
|
| Q |
101 |
cgaaatctgtaattgaaagtgactggcaaacaaacccatgcaannnnnnnnnaattaatcaaacccatgaaaatt---taggagtagcgttttacatgat |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39359665 |
cgaaatctgtaattgaaagtgactggcaaacaaactcatgcaatttttttttaattaatcaaacccatgaaaatttagtaggagtagcgttttacatgat |
39359566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University