View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_145 (Length: 266)
Name: NF3918_low_145
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_145 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 256
Target Start/End: Complemental strand, 3542441 - 3542187
Alignment:
| Q |
1 |
ttatcattgttctaattttgacgagtctctgaaactcgacgctggatggttattaaaaagaaaatagaatgagagagaatttgagtaggagtaaaattag |
100 |
Q |
| |
|
|||| |||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3542441 |
ttatgattgttctaattttgatgagtctctgaaacttgacgctggatggttattaaaaagaaaatagaatgagagagaatttgagtaggagtaaaattag |
3542342 |
T |
 |
| Q |
101 |
gagagtggagtgagctaaaataggagaaatagttgtaacaaattttattttatgatatggttttgaaattnnnnnnnnnnnngtaattttatgatatgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
3542341 |
gagagtggagtgagctaaaataggagaaatagttgtaacaaattttattttatgatatggttttgaaattaaaaataaaaaagtaattttatgatatgga |
3542242 |
T |
 |
| Q |
201 |
tagggtattgagacttttgaggtatgggaggggtcagagatagtttggtatctgtg |
256 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3542241 |
tagggtattgagacttttgaggtat-ggaggggtcagagatagtttggtatctgtg |
3542187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University