View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_146 (Length: 265)
Name: NF3918_low_146
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_146 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 20 - 255
Target Start/End: Original strand, 3451569 - 3451800
Alignment:
| Q |
20 |
acagtgaacgagaaatcattaacaatattacacgattaatctcagttaatgattttgtcgtaaatgcaaaagataactttccaagatttttgctcaaaac |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
3451569 |
acagtgaacgagaaatcattaacaatattacacgattaatctcagttaatgattttgtcgtaaatgcaaaagataactttcc-agatttttgctcaaaac |
3451667 |
T |
 |
| Q |
120 |
aaaaactttccaagattttataagaaccccnnnnnnnnnnnnnnnnnngacgaattataagaacccctttgtcgcgatttatgatattaaaatcctttct |
219 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3451668 |
aaaaactttccaagattttatacgaacccc---cttttttttttttttgacgaattataagaacccctttgtcgcgatttatgatattaaaatcctttct |
3451764 |
T |
 |
| Q |
220 |
gcctgaaaatcacataaattgataagtactcctatg |
255 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||| |
|
|
| T |
3451765 |
gcctaaaaatcgcataaattgataagtactcctatg |
3451800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University