View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_177 (Length: 248)
Name: NF3918_low_177
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_177 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 25 - 223
Target Start/End: Complemental strand, 28416039 - 28415842
Alignment:
| Q |
25 |
ccttccattcccctcaaaaactccaaaacaaagtctaggctacttgtcnnnnnnnnnngtactagtttatatatagaaaatgtcttagtactatgttttt |
124 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| | |||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
28416039 |
ccttccattcccctcaaaaactccgaaacaaagtctgggctacttgacataaaaaaa-gtactagtttatatatagaaaatgccttaatactatgttttt |
28415941 |
T |
 |
| Q |
125 |
gtcaaatagtctcggtagctataaattcatcatgtaaggttatgaagtgaggaatccatagtttcaactttgactcttgcataacaaaatgttcctacc |
223 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
28415940 |
gtcaaatagtctcggtggctataaattcatcatgtaaggttatgaagtgaggaatccatagtttcaactttgactcttgcacaacacaatgttcctacc |
28415842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University