View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_180 (Length: 247)
Name: NF3918_low_180
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_180 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 13000774 - 13000532
Alignment:
| Q |
1 |
gctgccccttattcccgaataatgatgagtcgagtattgaccgctgatgacaagagggataggatttaaccatggttacccttaaccatagttaatatct |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
13000774 |
gctgccccttattcccgaataatgatgagtcgagtattgaccgctgatgacaagagggataggatttaaccatggttacccttaaccatagtttatatct |
13000675 |
T |
 |
| Q |
101 |
aactctagttaagtggaggctattactgcaccaccctataaaaggacatcaccaacattgcaaatttccatcatctatttgtctttcacattacatcatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13000674 |
aactctagttaagtggaggctattactg---caccctataaaaggacatcaccaacattgcaaatttccatcatctatttgtctttcacattacatcatt |
13000578 |
T |
 |
| Q |
201 |
attgcacttcttatggtcgtttttacgattatttcctttgcttctc |
246 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
13000577 |
attgcacttcttatggtcgtttttacgataatttcctttgtttctc |
13000532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 246
Target Start/End: Complemental strand, 13075412 - 13075170
Alignment:
| Q |
1 |
gctgccccttattcccgaataatgatgagtcgagtattgaccgctgatgacaagagggataggatttaaccatggttacccttaaccatagttaatatct |
100 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13075412 |
gctgccccttatttccgaataatgatgagtcgagtattgaccgctgatgacaagagggataggatttaaccatggttacccttaaccatagttaatatct |
13075313 |
T |
 |
| Q |
101 |
aactctagttaagtggaggctattactgcaccaccctataaaaggacatcaccaacattgcaaatttccatcatctatttgtctttcacattacatcatt |
200 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13075312 |
aactctagttaagtggaagctattactg---caccctataaaaggacatcaccaacattgcaaatttccatcatctatttgtctttcacattacatcatt |
13075216 |
T |
 |
| Q |
201 |
attgcacttcttatggtcgtttttacgattatttcctttgcttctc |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
13075215 |
attgcacttcttatggtcgtttttacgattatttcctttgtttctc |
13075170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University