View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_187 (Length: 241)
Name: NF3918_low_187
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_187 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 20 - 241
Target Start/End: Complemental strand, 7943038 - 7942817
Alignment:
| Q |
20 |
acgagttcgttgaaagacaatacattggcaggaggcctaaagtatacaactttgttcaaggttcttggatcgtccactgctttaatggtataagtcccga |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7943038 |
acgagttcgttgaaagacaaaacattggcaggaggcctaaagtatacaactttgttcaaggttcttggatcgtccactgctttaatggtataagtcccga |
7942939 |
T |
 |
| Q |
120 |
tgtcttcctccgtgacataaactcctaaaacacaaatttcaaatgtacaattttaacaggtaatcgagtatgtccatgtagaaaagnnnnnnnnnttgaa |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
7942938 |
tgtcttcctccgtgacataaactcctaaaacacgaatttcaaatgtacaattttaacaggtaatcgagtatgtccatgtagaaaaaaaaaatgttttgaa |
7942839 |
T |
 |
| Q |
220 |
aagattttgtaagatgttacct |
241 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
7942838 |
aagattttgtaagatgttacct |
7942817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University