View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_192 (Length: 240)
Name: NF3918_low_192
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_192 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 181; Significance: 6e-98; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 35042520 - 35042754
Alignment:
| Q |
1 |
ctccatctacctgaaaatccaatccatgaatctttgcacattaaattaggtttcaattgtcttgagcagctatatcctgttgacaaccctacgttcccat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042520 |
ctccatctacctgaaaatccaatccatgaatctctgcacattaaattaggtttcaattgtcttgagcagctatatcctgttgacaaccctacgttcccat |
35042619 |
T |
 |
| Q |
101 |
aagcactgcacaatttaatcatcat-----------taagtacgtaatttaccttgcatttaatccataatatagtaacttgcaactcaagtgaacagtt |
189 |
Q |
| |
|
||||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35042620 |
aagcactgcacaatttaatcatcataatgttacccattagtacgtaatataccttgcatttaatccataatatagtaacttgcaactcaagtgaacggtt |
35042719 |
T |
 |
| Q |
190 |
ggattgaactcatcgaattaatcgtttcttagata |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
35042720 |
ggattgaactcatcgaattaatcgtttcttagata |
35042754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 34988958 - 34989067
Alignment:
| Q |
1 |
ctccatctacctgaaaatccaatccatgaatctttgcacattaaattaggtttcaattgtcttgagcagctatatcctgttgacaaccctacgttcccat |
100 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||||||||||||| | |||||||||| ||||| || |||||||||||||| |||||||||||||||| |
|
|
| T |
34988958 |
ctccacctaccagaaaatccaatccatgaatctttgcacattaaatcatgtttcaattgccttgaacaactatatcctgttgaaaaccctacgttcccat |
34989057 |
T |
 |
| Q |
101 |
aagcactgca |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
34989058 |
aagcactgca |
34989067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 13 - 42
Target Start/End: Complemental strand, 15560131 - 15560102
Alignment:
| Q |
13 |
gaaaatccaatccatgaatctttgcacatt |
42 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
15560131 |
gaaaatccaatccatgaatctttgcacatt |
15560102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University