View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_193 (Length: 239)
Name: NF3918_low_193
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_193 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 43; Significance: 0.000000000000001; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 89 - 143
Target Start/End: Complemental strand, 13856795 - 13856741
Alignment:
| Q |
89 |
gaatgaatggagttttaaggagtgttatatgttctgtaacatggtttatttcata |
143 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
13856795 |
gaatgaatggaattttaaggagtgttatatgtttggtaacatggtttatttcata |
13856741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 92 - 139
Target Start/End: Original strand, 14389751 - 14389798
Alignment:
| Q |
92 |
tgaatggagttttaaggagtgttatatgttctgtaacatggtttattt |
139 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14389751 |
tgaatgaagttttaaggagtgttatatgttttgtaacatggtttattt |
14389798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 96 - 140
Target Start/End: Complemental strand, 13881468 - 13881424
Alignment:
| Q |
96 |
tggagttttaaggagtgttatatgttctgtaacatggtttatttc |
140 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
13881468 |
tggagttttaagtagtgttatatgttttgtaacatggtttatttc |
13881424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 109 - 142
Target Start/End: Complemental strand, 16022377 - 16022344
Alignment:
| Q |
109 |
agtgttatatgttctgtaacatggtttatttcat |
142 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16022377 |
agtgttatatgttctgtaacatggtttatttcat |
16022344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University