View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_195 (Length: 239)
Name: NF3918_low_195
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_195 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 18 - 239
Target Start/End: Complemental strand, 6698550 - 6698329
Alignment:
| Q |
18 |
acttccctgcactttgcttttgcatacctattcttcataaggacttcaactgagccaacatttcaaggctatttccatcgtcgtttcatggctaaacaag |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
6698550 |
acttccctgcactttgcttttgcatacctattcttcataaggacttcaactgagccaacatttcaaggctatttccatcgtcgtttcatgtctaaacaag |
6698451 |
T |
 |
| Q |
118 |
agcgtcttatgaaggcatacaactttgatgcaaataggtataatgagctttgtaaagcttgttatccaagtaatcatgttggtgttggtgcaaatgcaaa |
217 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6698450 |
agcgtcttatgaagacatacaactttgatgcaaataggtataatgagctttgcaaagcttgttatccaagtaatcatgttggtgttggtgcaaatgcaaa |
6698351 |
T |
 |
| Q |
218 |
agctgaaacattttctccacct |
239 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
6698350 |
agctgaaacattttctccacct |
6698329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University