View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3918_low_199 (Length: 238)

Name: NF3918_low_199
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3918_low_199
NF3918_low_199
[»] chr6 (2 HSPs)
chr6 (1-94)||(7004731-7004824)
chr6 (152-222)||(7004602-7004672)


Alignment Details
Target: chr6 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 7004824 - 7004731
Alignment:
1 tcattatttatatgttttggattatgttggttaattgaaaattgtagcataatgcattgccaaattcttagtagagtgtaatatgttaccttga 94  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
7004824 tcattatttatatgttttggattatgttggttaattgaaaattgtagcataatgaattgccaaattcttagtagagtgtaatatgttaccttga 7004731  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 152 - 222
Target Start/End: Complemental strand, 7004672 - 7004602
Alignment:
152 caagaaggcatgttccatttttcttctgagccacatctttgtcaacttgtaaggatttttatctcattcat 222  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7004672 caagaaggcatgttccatttttcttctgagccacatctttgtcaacttgtaaggatttttatctcattcat 7004602  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University