View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_20 (Length: 612)
Name: NF3918_low_20
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_20 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 127; Significance: 3e-65; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 127; E-Value: 3e-65
Query Start/End: Original strand, 458 - 592
Target Start/End: Original strand, 8030278 - 8030412
Alignment:
| Q |
458 |
accgatttgatatagcataacttacaatcttcaagcaatgattctacaacattcagaatggtcctcaatttgcggttttcggtggaagttatggtggagt |
557 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8030278 |
accgatttgatatagcataacttacaatcttcaagcaatgattcagcaacattcagaatggtcctcaatttgcggttttcggtggaagttatggtggagt |
8030377 |
T |
 |
| Q |
558 |
tgttgtcaatatgttgtttttgtgtgggttgaggg |
592 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
8030378 |
tgttgtcaatatgttgtttttgtgtgggttgaggg |
8030412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University