View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_207 (Length: 236)
Name: NF3918_low_207
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_207 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 15 - 236
Target Start/End: Complemental strand, 55987390 - 55987167
Alignment:
| Q |
15 |
atctttatcatataccgtgtgattgtgcattatttggtttatctttttattccaccaactgtgattttcttgattaatcaattcatgagatatcaattgg |
114 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55987390 |
atctttatcatctaccgtgtgattgtgcattatttggtttatctttttattccaccaactgtgattttcttgattaatcaattcatgagatatcaattgg |
55987291 |
T |
|
| Q |
115 |
aagnnnnnnnnn--gctaaggaaactcggtttgctagctttgttagatggtcctttaaatcaagcacatgatcattcgatgtctatcaacttggatgttt |
212 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55987290 |
aagtttttttttttgctaaggaaactcggtttgctagctttgttagatggtcctttaaatcaagcacatgatcattcgatgtctatcaacttggatgttt |
55987191 |
T |
|
| Q |
213 |
gatgagagtattgtcacaaatgac |
236 |
Q |
| |
|
|||||||| ||||||| ||||||| |
|
|
| T |
55987190 |
gatgagagaattgtcataaatgac |
55987167 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University