View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_208 (Length: 236)
Name: NF3918_low_208
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_208 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 45783466 - 45783684
Alignment:
| Q |
1 |
aacattcaaaacagagtcacatgctaaacgggtgtgtcttgtttcaatcttttattcttcgtggatcgcatcaccatgctctaatttagaactgtaaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
45783466 |
aacattcaaaacagagtcacatgctaaacgggcgtgccttgtttcaatcttttattcttcgtggatcgcatcaccatgttctaatttagaactgtaaatc |
45783565 |
T |
|
| Q |
101 |
aagaaagaaagataaacattatattcaatgagat-nnnnnnnnnngctaggagaacaatatacaatgatataataaagaaattaccgcaaccaaaagatg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45783566 |
----aagaaagataaacattatattcaatgagataaaaaaaagaagctaggagaacaatatacaatgatataataaagaaattaccgcaaccaaaagatg |
45783661 |
T |
|
| Q |
200 |
ggaggttgcactgagaagtaagt |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45783662 |
ggaggttgcactgagaagtaagt |
45783684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University