View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_222 (Length: 225)
Name: NF3918_low_222
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_222 |
 | |
|
| [»] scaffold0229 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 213
Target Start/End: Complemental strand, 50608841 - 50608646
Alignment:
| Q |
18 |
tgttgcatatgaagtaaccacctctcggcagcttcatgtgtcacaggaaatggtcgatgtctagcaattagagcaggatgtcctgtaatgtgaagtacgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50608841 |
tgttgcatatgaagtaaccacctctcggcagcttcatgtgtcacaggaaatggtcgatgtctagcaattagagcaggatgtcctgtaatgtgaagtacgg |
50608742 |
T |
|
| Q |
118 |
tatcaaagattttgaatttcaagttgctttgttttattattactctattttcagtgtgatatatcaatatataaaattctttccaatttctgtgat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
50608741 |
catcaaagattttgaatttcaagttgctttgttttattattactctattttcagtgtgatatatcaatatataaaattctttccattttctgtgat |
50608646 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0229 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: scaffold0229
Description:
Target: scaffold0229; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 20758 - 20675
Alignment:
| Q |
19 |
gttgcatatgaagtaaccacctctcggcagcttcatgtgtcacaggaaatggtcgatgtctagcaattagagcaggatgtcctg |
102 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||| |||||| || ||||||||| |||||| | |||||||||||||||| |||| |
|
|
| T |
20758 |
gttgcatgtgatgtaaccacctctccgcagcttgatgtgtgactggaaatggttgatgtcgaccaattagagcaggatgacctg |
20675 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 44; Significance: 3e-16; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 19 - 102
Target Start/End: Complemental strand, 1029933 - 1029850
Alignment:
| Q |
19 |
gttgcatatgaagtaaccacctctcggcagcttcatgtgtcacaggaaatggtcgatgtctagcaattagagcaggatgtcctg |
102 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||| |||||| || ||||||||| |||||| | |||||||||||||||| |||| |
|
|
| T |
1029933 |
gttgcatgtgatgtaaccacctctccgcagcttgatgtgtgactggaaatggttgatgtcgaccaattagagcaggatgacctg |
1029850 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University