View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_61 (Length: 431)
Name: NF3918_low_61
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 6e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 6e-87
Query Start/End: Original strand, 13 - 182
Target Start/End: Complemental strand, 2951909 - 2951739
Alignment:
| Q |
13 |
gatttcacatcatcctcattcaggaaagttttgatatttacatcaattatcatattaacaccctaattatttccctttagattttttctcacaatggctt |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2951909 |
gatttcacatcatcctcattcaggaaagttttgatatttacatcaattatcatattaacaccctaattatttccctttagattttttctcacaatggctt |
2951810 |
T |
 |
| Q |
113 |
ataaattgttactagtttttgtgttataaccgttatacattgcaga-ttttgcaaccaaaaaagtaaattc |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2951809 |
ataaattgttactagtttttgtgttataaccgttatacattgcagatttttgcaaccaaaaaagtaaattc |
2951739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 124; E-Value: 1e-63
Query Start/End: Original strand, 220 - 343
Target Start/End: Complemental strand, 2951701 - 2951578
Alignment:
| Q |
220 |
tacttggtaatatggaaataggatttgctagatccattggaaggaagagggtagttgtttccgaaatagggtctccccttgaaacccttcctcaagatat |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2951701 |
tacttggtaatatggaaataggatttgctagatccattggaaggaagagggtagttgtttccgaaatagggtctccccttgaaacccttcctcaagatat |
2951602 |
T |
 |
| Q |
320 |
tctggtaaattaatatttcaatca |
343 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
2951601 |
tctggtaaattaatatttcaatca |
2951578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University