View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_64 (Length: 426)
Name: NF3918_low_64
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_64 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 14 - 270
Target Start/End: Complemental strand, 34821426 - 34821170
Alignment:
| Q |
14 |
gaaccacaaaaaatttaaaaagttgagctttagtgtttcgcctttagatcatcttgagacgatgagtaacatttcaccggaagataagcaagactaagga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34821426 |
gaaccacaaaaaatttaaaaagttgagctttagtgttttgcctttagatcatcttgagacgatgagtaacatttcaccggaagataagtaagactaagga |
34821327 |
T |
 |
| Q |
114 |
ggagaaacaaatgtccaatataatatctataatccattttcaagctagcaaaatgacacaacaacnnnnnnnggttaataacatgtgttaatatatgcat |
213 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34821326 |
ggagaaacaaatgcccaatataatatctataatccattttcaagctagcaaaatgacacaacaacaaaaaaaggttaataacatgtgttaatatatgcat |
34821227 |
T |
 |
| Q |
214 |
gcatgcaagttcctttaagtaaacttgtgtgttttatatcatatttgtttccccttc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34821226 |
gcatgcaagttcctttaagtaaacttgtgtgttttatatcatatttgtttccccttc |
34821170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University