View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3918_low_81 (Length: 370)
Name: NF3918_low_81
Description: NF3918
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3918_low_81 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 321; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 321; E-Value: 0
Query Start/End: Original strand, 18 - 365
Target Start/End: Original strand, 29677503 - 29677851
Alignment:
| Q |
18 |
acaaagacaatggataacccc-caaaataacctcattcggatctaaaatcgggtcggagtttgggtcgggttgtatcatgatcgggattgtacccgcttt |
116 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
29677503 |
acaaagacaatggataaccccccaaaataacctcattcggatctaaagtcgggtcggagtttgggtcgggttgcatcatgatcggggttgtacccgcttt |
29677602 |
T |
 |
| Q |
117 |
ttgaaacccggtatccaccaactccaacccatgacccggttcatcctcaatctcctgtgaagacgtgccaggtgtcaccccctccaagtgacccacctat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677603 |
ttgaaacccggtatccaccaactccaacccatgacccgcttcatccccaatctcctgtgaagacgtgccaggtgtcaccccctccaagtgacccacctat |
29677702 |
T |
 |
| Q |
217 |
agcacgtgatcaatctcttttctcatcatgtgactggattgctccccttctccaaacagaacatcattatcttcactgccaccttttacctctacagctt |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677703 |
agcacgtgatcaatctcttttctcatcatgtgactggattgctccccttctccaaacagaacatcattatcttcactgccaccttttacctctacagctt |
29677802 |
T |
 |
| Q |
317 |
gtacttttcctaaagtttccttttgttctcaattgactctcccacctcc |
365 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29677803 |
gtacttttcctaaagtttccttttgttctcaattgactctcccacctcc |
29677851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University