View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3919_low_23 (Length: 237)
Name: NF3919_low_23
Description: NF3919
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3919_low_23 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 20 - 213
Target Start/End: Original strand, 1715599 - 1715793
Alignment:
| Q |
20 |
atagaaacaagatgggttgtggaagtagtctctcttttggcnnnnnnnnnnnnnn-gtaatcccttcattcttatttgtcagcaaaaattgtggtctcaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
1715599 |
atagaaacaagatgggttgtggaagtagtctctcttttggcaaaaaaaaaaaaaaagtaatcccttcattcttatttatcagcaaaa-ttgtggtctcaa |
1715697 |
T |
 |
| Q |
119 |
atataagaaaaatttgttaaattcaaccctatttagtattatt-gttttaaaaatactgcttacttcaaactcaatttatttccagagcaagtaca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
1715698 |
atataagaaaaatttgttaaattcaaccctatttagtattattatttttaaaaatactgcttacttcaaactcaatttatttacagagcaagtaca |
1715793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 102 - 130
Target Start/End: Original strand, 8740718 - 8740746
Alignment:
| Q |
102 |
aaaaattgtggtctcaaatataagaaaaa |
130 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8740718 |
aaaaattgtggtctcaaatataagaaaaa |
8740746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University