View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3920_high_2 (Length: 516)
Name: NF3920_high_2
Description: NF3920
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3920_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 136; Significance: 1e-70; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 136; E-Value: 1e-70
Query Start/End: Original strand, 362 - 501
Target Start/End: Complemental strand, 47212886 - 47212747
Alignment:
| Q |
362 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggtatattattcggtttttgctctggtttg |
461 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47212886 |
aagcttgcttgtttggcgaatccgaaaacaacaactcttgaaacatcatacaacaaagttcatgaaggaaggtatattattcggtttttgctctggtttg |
47212787 |
T |
|
| Q |
462 |
tagggggaatgggaatattagaaatcttgtgcttatttct |
501 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
47212786 |
tagggggaatgggagtattagaaatcttgtgcttatttct |
47212747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University