View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3921_high_19 (Length: 238)
Name: NF3921_high_19
Description: NF3921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3921_high_19 |
 | |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 17 - 238
Target Start/End: Original strand, 36839849 - 36840070
Alignment:
| Q |
17 |
actaagctaccgatgtctcaaatgtatgaatgcaggattccctcgcagccaggaatctgaaagtagaagggtagcctagcataccaaggcgcgattttca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36839849 |
actaagctaccgatgtctcaaatgtatgaatgcaggattccctcgcagccaggaatctgaaagtagaagggtagcctagcataccaaggcgcgattttca |
36839948 |
T |
|
| Q |
117 |
gatgattgactttgtgttgatagactttcacgcgaatgaggttctctctttccaaggcagtaaaaattgagataatcttgtggatgataacattcagaga |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36839949 |
gatgattgactttgtgttgatagactttcacgcgaatgaggttctctctttccaaggcagtaaaaattgagataatcttgtggatgataacattcagaga |
36840048 |
T |
|
| Q |
217 |
gacctgcttttgcaagtgcatc |
238 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
36840049 |
gacctgcttttgcaagtgcatc |
36840070 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University