View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3921_low_15 (Length: 256)
Name: NF3921_low_15
Description: NF3921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3921_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 19626852 - 19626621
Alignment:
| Q |
9 |
gagatgaagttccagatgagaaatcctctctttcaacgaggccgacacggagtccacgtgtggtggcatccagggcaacgccggtaccggtggctcctcc |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19626852 |
gagaagaagttccagatgagaaatcctctctttcaacgaggccgacacggagtccacgtgtggtggcatccagggcaacgccggtaccggtggctcctcc |
19626753 |
T |
 |
| Q |
109 |
gccaattacgagaatgtcgagcgggttagcggaggtggagccaatgagtgacgactgctgaacttgtctggacgggaggacggcgtttgggtcgtggatc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19626752 |
gccaattacgagaatgtcgagcgggttagcggaggtggagccaatgagtgacgactgctgaacttgtctggacgggaggacggcgtttgggtcgtggatc |
19626653 |
T |
 |
| Q |
209 |
ttctgttggaaagctgcgacctgggatccatg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19626652 |
ttctgttggaaagctgcgacctgggatccatg |
19626621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University