View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3921_low_9 (Length: 324)
Name: NF3921_low_9
Description: NF3921
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3921_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 15 - 307
Target Start/End: Complemental strand, 30483003 - 30482710
Alignment:
| Q |
15 |
agattgggctatcgagcacttattttcaggtgtgaacatgcatcttaatt----cttgaatttgattaatagtattagtatttggatcttcaaaaattaa |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30483003 |
agattgggctatcgagcacttattttcaggtgtgaacatgcatcttaattaattcttgaatttgattaatagtattagtatttggatcttcaaaaattaa |
30482904 |
T |
 |
| Q |
111 |
taatatcatgcattaatttatggcagtggtgatcatgatatgtgtgtaccatttactggaagtgaggcttggaccagatctttgggatacaaggttgtgg |
210 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30482903 |
ta---tcatgcattaatttatggcagtggtgatcatgatatgtgtgtaccatttactggaagtgaggcttggaccagatctttgggatacaaggttgtgg |
30482807 |
T |
 |
| Q |
211 |
atgagtggaggtcatggatctccaatgaccaagttgctgggtatattaatttctctctcactctcacatatttcaatacctaccaaaaataattgct |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30482806 |
atgagtggaggtcatggatctccaatgaccaagttgctgggtacattaatttctctctcactctcacatatttcaatacctaccaaaaataattgct |
30482710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 131 - 253
Target Start/End: Complemental strand, 18010712 - 18010590
Alignment:
| Q |
131 |
tggcagtggtgatcatgatatgtgtgtaccatttactggaagtgaggcttggaccagatctttgggatacaaggttgtggatgagtggaggtcatggatc |
230 |
Q |
| |
|
|||||||||||||||||| |||||||| |||| |||||||| ||| |||||||| | ||| | ||||| ||| |||| ||||| |||||| | ||| | |
|
|
| T |
18010712 |
tggcagtggtgatcatgacatgtgtgtcccatatactggaactgaagcttggacaaaatcaattggatataagattgttgatgaatggaggccttggtta |
18010613 |
T |
 |
| Q |
231 |
tccaatgaccaagttgctgggta |
253 |
Q |
| |
|
||||||| ||| |||||||||| |
|
|
| T |
18010612 |
accaatgatcaaattgctgggta |
18010590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 131 - 171
Target Start/End: Complemental strand, 18019177 - 18019137
Alignment:
| Q |
131 |
tggcagtggtgatcatgatatgtgtgtaccatttactggaa |
171 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18019177 |
tggcagtggtgatcatgatatgtgtgtcccatttactggaa |
18019137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 133 - 253
Target Start/End: Complemental strand, 3022643 - 3022523
Alignment:
| Q |
133 |
gcagtggtgatcatgatatgtgtgtaccatttactggaagtgaggcttggaccagatctttgggatacaaggttgtggatgagtggaggtcatggatctc |
232 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| ||| | || ||||| ||||| | ||||||||| |||| ||||| |||||| ||||| | || |
|
|
| T |
3022643 |
gcagtggtgatcatgacatgtgtgttccatttactgggagtcaagcatggacgagatcaattggatacaagattgttgatgaatggaggccatggttatc |
3022544 |
T |
 |
| Q |
233 |
caatgaccaagttgctgggta |
253 |
Q |
| |
|
||||| ||||||| |||||| |
|
|
| T |
3022543 |
caatggtcaagttgttgggta |
3022523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University