View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3922_high_5 (Length: 240)
Name: NF3922_high_5
Description: NF3922
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3922_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 61 - 230
Target Start/End: Complemental strand, 55266031 - 55265868
Alignment:
| Q |
61 |
atttctcataaaatatagcaaaaactagcgataagatatttatccttaccaacagacatccctcactcactcactcctctgttctgttcagtggttagtt |
160 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
55266031 |
atttctcataaaatatag-aaaaactagcgataagatatttatccttaccaacagacatccctcactcactcactcctctgttc-----agtggttagtt |
55265938 |
T |
 |
| Q |
161 |
aacacgtttatcttggctgattgcatgtttttgagcttatttatggtttggttatatgaatgtgtctgtg |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
55265937 |
aacacgtttatcttggctgattgcatgtttttgagcttatttatggtttggttatgtgaatgtgtttgtg |
55265868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 68 - 132
Target Start/End: Complemental strand, 55271916 - 55271852
Alignment:
| Q |
68 |
ataaaatatagcaaaaactagcgataagatatttatccttaccaacagacatccctcactcactc |
132 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||| |
|
|
| T |
55271916 |
ataaaatgtagcaaaaactagcaataagatagttatccttaccgacagacatcccacactcactc |
55271852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 150 - 197
Target Start/End: Complemental strand, 55271840 - 55271793
Alignment:
| Q |
150 |
agtggttagttaacacgtttatcttggctgattgcatgtttttgagct |
197 |
Q |
| |
|
|||||||||||||||| ||| |||| ||||||||||||| |||||||| |
|
|
| T |
55271840 |
agtggttagttaacacttttgtctttgctgattgcatgtgtttgagct |
55271793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University