View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3923_high_5 (Length: 329)
Name: NF3923_high_5
Description: NF3923
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3923_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 1 - 303
Target Start/End: Original strand, 29958515 - 29958817
Alignment:
| Q |
1 |
tcaataaggaatgcatcaaggttcttgatggaggaatccacccttgcagaactgttcatttgcaacatctggttaaataatgtttttgcagcctcattaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958515 |
tcaataaggaatgcatcaaggttcttgatggaggaatccacccttgcagaactgttcatttgcaacatctggttaaataatgtttttgcagcctcattaa |
29958614 |
T |
 |
| Q |
101 |
tcgaaggctggtacttaacaacacgtccatcaagaggattatggggattcttggtgtctaaactatcttcttcctgcccctggagccgcctctttttacc |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29958615 |
tcgaaggctggtacttaacaacacgcccatcaagaggattatggggattcttggtggctaaactatcttcttcctgcccctggagccgcctctttttacc |
29958714 |
T |
 |
| Q |
201 |
tgcggtaacatgtctattactttcattctgctgctgtgaaaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatcttttgc |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
29958715 |
tgcggtaacatgtctattactttcattctgctgctgtgaaaattgagccataaagcccggactattcatggcctttgccagaaaggacatcatctgttgc |
29958814 |
T |
 |
| Q |
301 |
tga |
303 |
Q |
| |
|
||| |
|
|
| T |
29958815 |
tga |
29958817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University