View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3924_high_4 (Length: 234)
Name: NF3924_high_4
Description: NF3924
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3924_high_4 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 4175457 - 4175245
Alignment:
| Q |
1 |
ttattttagatatttatcattattggtttttgtcattgttacaataaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtgcagtggag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175457 |
ttattttagatatttatcattattggtttttgtcattgttacaacaaatatttatgaaatgtatgggctattgtgcagccaagagttgcgtgcagtggag |
4175358 |
T |
|
| Q |
101 |
aggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttcacggttggtcaagattgaaccaagtccaaatggggata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4175357 |
aggagggtacttttggaaaccttggctggacaactgcctacggataccattcaatattcttcacggttggtcaagattgaaccaagtccaaatggggata |
4175258 |
T |
|
| Q |
201 |
ccttcttggaatt |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
4175257 |
ccttcttggaatt |
4175245 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 106; E-Value: 3e-53
Query Start/End: Original strand, 47 - 221
Target Start/End: Complemental strand, 4171423 - 4171247
Alignment:
| Q |
47 |
aatatttatgaaatgtat--gggctattgtgcagccaagagttgcgtgcagtggagaggagggtacttttggaaaccttggctggacaactgcctacgga |
144 |
Q |
| |
|
||||||||||||||| || ||| ||||||||||||||||| ||||||||||||||||||| |||||||||||||| ||||||| || | ||| | || |
|
|
| T |
4171423 |
aatatttatgaaatgcataaggggtattgtgcagccaagaggtgcgtgcagtggagaggagagtacttttggaaactttggctgctcagttacctcctga |
4171324 |
T |
|
| Q |
145 |
taccattcaatattcttcacggttggtcaagattgaaccaagtccaaatggggataccttcttggaattctttgatg |
221 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
4171323 |
tagcattcaatattcttcacggttggtcaagattgaaccaagtccaaatggggataccttattggaattcttggatg |
4171247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University