View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3925_low_6 (Length: 399)
Name: NF3925_low_6
Description: NF3925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3925_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 2e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 64 - 229
Target Start/End: Complemental strand, 39066022 - 39065855
Alignment:
| Q |
64 |
acggttatcaagtacaacacacacacgttagttnnnnnnnnnn--gtactactccctgttatgttgttctacgcgcatgcacaaatgcaatcattataaa |
161 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39066022 |
acggttatcaagtacaacacacacacgttagttaaaaaataaaaagtactactccctgttatgttgttctacgcgcatgcacaaatgcaatcattataaa |
39065923 |
T |
 |
| Q |
162 |
aatggttagggttttgttcatcttcttactaactaactggactttggggtaccaaaatgaactaatta |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39065922 |
aatggttagggttttgttcatcttcttactaactaactggactttggggtaccaaaatgaactaatta |
39065855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000004
Query Start/End: Original strand, 277 - 320
Target Start/End: Complemental strand, 39065797 - 39065754
Alignment:
| Q |
277 |
tgggtcatgtcaactagtgttcttgaaacattggttgagaaaac |
320 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39065797 |
tgggtcaagtcaactagtgttcttggaacattggttgagaaaac |
39065754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University