View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3925_low_7 (Length: 382)
Name: NF3925_low_7
Description: NF3925
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3925_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 136; Significance: 7e-71; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 136; E-Value: 7e-71
Query Start/End: Original strand, 17 - 217
Target Start/End: Original strand, 7682463 - 7682662
Alignment:
| Q |
17 |
cttggaagaatcaaaatgctgccattcctctaataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttggg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7682463 |
cttggaagaatcaaaatgctgccattcctctaataattaatgtcgagagtgaacaattggtggatcatgtccaattctcatattgaaagtggtttttggg |
7682562 |
T |
 |
| Q |
117 |
taattcgtctagatcctcctggtctgtagaacactcttca---tatttgtttgctcagataaactttagatgattcttgataattttatcttttcggtta |
213 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||| | | |||| |||||| ||||||||||| ||||| |||||||||||||||||||||||| |
|
|
| T |
7682563 |
taattcgtctagatcctcctggtctgta-aatcctcattaggtgatttttttgct---ataaactttaggtgatttttgataattttatcttttcggtta |
7682658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University