View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF3926_high_8 (Length: 249)

Name: NF3926_high_8
Description: NF3926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF3926_high_8
NF3926_high_8
[»] chr6 (1 HSPs)
chr6 (18-239)||(32314852-32315076)


Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 32314852 - 32315076
Alignment:
18 gcattgacattttagattgaacatgtgttcagtgtcgaacacatttattggt-----acagaggcagtaacaacaacaccgatttcatcaatatggtgtg 112  Q
    ||||||| ||||||||||||||||||||||| ||||||||||||||||||||     ||| ||||| |||||||||||||||||||||||||||||||||    
32314852 gcattgatattttagattgaacatgtgttcaatgtcgaacacatttattggtgtgtgacacaggcaataacaacaacaccgatttcatcaatatggtgtg 32314951  T
113 atcaagatgttcaaatggagtacactatcattcgtttagataacttttgaagaacnnnnnnncggcgcaaaaatattagaaggccaacaaaatccacaaa 212  Q
    |||||||||||||||   ||||||||||||||  || ||||||||||||||||||       ||| ||||||||||| ||||||||||||||||||||||    
32314952 atcaagatgttcaaaaa-agtacactatcattaatt-agataacttttgaagaactttttttcggtgcaaaaatattggaaggccaacaaaatccacaaa 32315049  T
213 atcagtacgttagattcctttttcatc 239  Q
    |||||||||||||||||||||||||||    
32315050 atcagtacgttagattcctttttcatc 32315076  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University