View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3926_low_9 (Length: 249)
Name: NF3926_low_9
Description: NF3926
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3926_low_9 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 32314852 - 32315076
Alignment:
| Q |
18 |
gcattgacattttagattgaacatgtgttcagtgtcgaacacatttattggt-----acagaggcagtaacaacaacaccgatttcatcaatatggtgtg |
112 |
Q |
| |
|
||||||| ||||||||||||||||||||||| |||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32314852 |
gcattgatattttagattgaacatgtgttcaatgtcgaacacatttattggtgtgtgacacaggcaataacaacaacaccgatttcatcaatatggtgtg |
32314951 |
T |
|
| Q |
113 |
atcaagatgttcaaatggagtacactatcattcgtttagataacttttgaagaacnnnnnnncggcgcaaaaatattagaaggccaacaaaatccacaaa |
212 |
Q |
| |
|
||||||||||||||| |||||||||||||| || |||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
32314952 |
atcaagatgttcaaaaa-agtacactatcattaatt-agataacttttgaagaactttttttcggtgcaaaaatattggaaggccaacaaaatccacaaa |
32315049 |
T |
|
| Q |
213 |
atcagtacgttagattcctttttcatc |
239 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
32315050 |
atcagtacgttagattcctttttcatc |
32315076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University