View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3927_high_12 (Length: 351)
Name: NF3927_high_12
Description: NF3927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3927_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 5 - 244
Target Start/End: Complemental strand, 44494919 - 44494680
Alignment:
| Q |
5 |
tacactattctcttttttatattttacactataatttagttaatttttggcatatcatattaacttatgtgggttttatttcctagcaattaagtgaatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494919 |
tacactattctcttttttatattttatactataatttagttaatttttggcatatcatattaacttatgtgggttttatttcctagcaattaagtgaatc |
44494820 |
T |
|
| Q |
105 |
catttttaagttgtatgataaattttgcttttagcctcttaagaaaattataatattaaaatttaatcgagtattgtttgtttatgttttaacaacatta |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494819 |
catttttaagttgtatgataaattttgcttttagcctcttaagaaaattataatattaaaatttaatcgagtattgtttgtttatgttttaacaacatta |
44494720 |
T |
|
| Q |
205 |
tatcaaccgatgaaaagacagatattatacatgccatcac |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44494719 |
tatcaaccgatgaaaagacagatattatacatgccatcac |
44494680 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University