View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3927_low_20 (Length: 274)
Name: NF3927_low_20
Description: NF3927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3927_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 2 - 259
Target Start/End: Complemental strand, 40218410 - 40218154
Alignment:
| Q |
2 |
ctttttcgccagtacacataatacatatggtataacacagttttaatataaataggaaagttaaagtttaagaagaatggaatgatttacctacacgagt |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40218410 |
ctttttcgccagtacacataatacatatggtataacacagttttaatataaataggaaagttaaagtttaagaagaatggaatgatttacctacacgagt |
40218311 |
T |
|
| Q |
102 |
tgaaataaaataattttgtaatttgaatannnnnnnnnaatttatcatttgtttttagaacgtttctaacttctaagtcatggtcatgcaaaacttatgg |
201 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
40218310 |
tgaaataaaataattttgtaatttgaata-ttttttttaatttatcatttgtttttagaacgtttctaacttctaagtcatggtcacgcaaaacttatgg |
40218212 |
T |
|
| Q |
202 |
agtatcagtatataactgattttggtaaggagaggttgacagttactagtatatatat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40218211 |
agtatcagtatataactgattttggtaaggagaggttgacagttactagtatatatat |
40218154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University