View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3927_low_22 (Length: 244)
Name: NF3927_low_22
Description: NF3927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3927_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 13 - 225
Target Start/End: Original strand, 52577680 - 52577892
Alignment:
| Q |
13 |
gcagcacagatgtggttccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaaca |
112 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577680 |
gcagcacaaatgtggttccctgcactatatatatgttgctgttaagtcttggaaacattgtttttataaaaatgctttgatttgatgtgctagacgaact |
52577779 |
T |
|
| Q |
113 |
agcattttaattgaggggaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggttt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52577780 |
agcattttaattgaggggaggaacaaaagactatatattaagatgatgtttatattggaaatgcctaatcaccttattccctcttgagatgcgaaggttt |
52577879 |
T |
|
| Q |
213 |
cctgaatgcgata |
225 |
Q |
| |
|
||||||||||||| |
|
|
| T |
52577880 |
cctgaatgcgata |
52577892 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University