View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3927_low_4 (Length: 469)
Name: NF3927_low_4
Description: NF3927
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3927_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 2e-37; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 43 - 126
Target Start/End: Original strand, 10126641 - 10126724
Alignment:
| Q |
43 |
acttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaat |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10126641 |
acttccaagaagaaagtgaatcgaatttactccctttagaaggatcatggagtgagggtgactgacaacccgggtatgtgtaat |
10126724 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 77 - 137
Target Start/End: Original strand, 10126724 - 10126784
Alignment:
| Q |
77 |
tttagaaggatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa |
137 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10126724 |
tttagaatgatcatggagtgagggtgactgacaacccgggtatgagtaatactgctcaaaa |
10126784 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University