View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_27 (Length: 441)
Name: NF3929_high_27
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_27 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 356; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 356; E-Value: 0
Query Start/End: Original strand, 18 - 434
Target Start/End: Original strand, 49071396 - 49071811
Alignment:
| Q |
18 |
agcaccagaacgctggagtgccgttcactctttttcaaccatcagatgaatttaatgctcaaaattaagccatgcggccatctcctaaactttttatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49071396 |
agcaccagaacgctggagtgccgttcactctttttcaaccatcagatgaatttaatgctcaaaattaagccatgcggccatctcctaaactttttatttg |
49071495 |
T |
 |
| Q |
118 |
ttaagcttaaaactactcgcatgtctagtaattgaccctctctttaaccctgtatgcgatgcgtgggggagataaaagcagtggcctgattcccgaagtt |
217 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||||||||||||||||||||| || |||||||| |
|
|
| T |
49071496 |
ttaagcttaaaactactcgcatgtccagtaattgaccctctctt-aaccctgtatgctatgcgtgggggagataaaagcagtggcctggttgccgaagtt |
49071594 |
T |
 |
| Q |
218 |
tgtacaccaccgtctctgcaaaatacgactgatgaaaaaagaaatgaagggaagtatctgagctacatgactggttgtaggaaggtttcgttaagggtgt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49071595 |
tgtacaccaccgtctctgcaaaatacgactgacaaaaaaagaaatgaagggaagtatctgagctacatgactggttgtaggaaggtttcgttaagggtgt |
49071694 |
T |
 |
| Q |
318 |
ttgattgaggctgacagagcagcgattagcgatggctgcggagcctggcctgtggatatagaggtcctcttcttttacattttactcnnnnnnncctttc |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
49071695 |
ttgattgaggctgacagagcagcgattagcgatggctgcggagcccggcctgtggatatagaggtcctcttcttttacattttactctttttttcctttc |
49071794 |
T |
 |
| Q |
418 |
tgctattttcctttgct |
434 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
49071795 |
tgctattttcgtttgct |
49071811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University