View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_59 (Length: 302)
Name: NF3929_high_59
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_59 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 14 - 289
Target Start/End: Original strand, 10297464 - 10297742
Alignment:
| Q |
14 |
ggacagttcatttgccattgcctggaaaaatatttcccatttatggaagtggaagtcttgttgtcaatctcataaaatttattatcattttggttatgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10297464 |
ggacagttcatttgccattgcctggaaaaatatttcccatttatggaagttgaagtcttgttgtcaatctcataaaatttattatcattttggttatgaa |
10297563 |
T |
 |
| Q |
114 |
ctcgggttggtttgtctactttgatagattatgacaaaaactattcgacataaattggacaagacatttatgagatgaatctgtcaaaaaagaaaaccat |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10297564 |
ctcgggttggtttgtctactttgatagattatgacaaaaactattcgacataaattggacaagacatttatgagatgaatctgtcaaaaaagaaaaccat |
10297663 |
T |
 |
| Q |
214 |
ttcc---ctgatgaactgcacaatgtttttcttgggttggctgagaaaagtcaaattgtaacttcttatgttaaaagtg |
289 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
10297664 |
ttccatattgatgaactgcacaatgcttttcttgggttggctaacaaaagtcaaattgtaacttcttatgttaaaagtg |
10297742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University