View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_78 (Length: 253)
Name: NF3929_high_78
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_78 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 142; Significance: 1e-74; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 24 - 181
Target Start/End: Complemental strand, 9439667 - 9439510
Alignment:
| Q |
24 |
cataggagtgagaaagtatttggatagtaagaaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaatccat |
123 |
Q |
| |
|
||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9439667 |
cataggagtgacaaagtatttggatagtaagcaaaaggtagaagaaaaccagaggttactctgcagagtcagatacaacattttctatccttaaatccat |
9439568 |
T |
|
| Q |
124 |
taggatagatcctcttccactctcccactttcttcttataatttttgcgaattccctc |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
9439567 |
taggatagatcctcttccactctcccactttcttcatataattcttgcgaattccctc |
9439510 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University