View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_85 (Length: 250)
Name: NF3929_high_85
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_85 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 94 - 231
Target Start/End: Complemental strand, 44309539 - 44309401
Alignment:
| Q |
94 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatc-aaaagtctactaaattgatg |
192 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
44309539 |
ttttgttgaaattcattttaactcaaccctcctcttcaaacatatctgcaaccaatttttccttatccaatgcaacatcaaaaagtctactaaattgatg |
44309440 |
T |
 |
| Q |
193 |
acgcaaaatgcatatctattaatgacgaaaaatgttgca |
231 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44309439 |
acgcaaaatgtatatctattaatgacgaaaaatgttgca |
44309401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 1 - 97
Target Start/End: Complemental strand, 44310074 - 44309978
Alignment:
| Q |
1 |
ttatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggaccttttt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310074 |
ttatgtcaatctctttcacaatggactggtggtagttcatagtatgcatctcaagacaaggtttttggaaagctattatgagaagttggaccttttt |
44309978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 52 - 244
Target Start/End: Complemental strand, 18701354 - 18701145
Alignment:
| Q |
52 |
caagacaaggtttttggaaagctattatgagaagttggacctttttgtt----------------gaaattcattttaactcaaccctcctcttcaaaca |
135 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
18701354 |
caagacaaggtttttggaaagctattatgagaagttggacctttttattttatttactgtctattgaaattcattttaactcaaccctcctcttcaaaca |
18701255 |
T |
 |
| Q |
136 |
tatctgcaaccaatttttccttatccaatgcaacatc-aaaagtctactaaattgatgacgcaaaatgcatatctattaatgacgaaaaatgttgcaggg |
234 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||| ||||||| ||||||||||||||||||||||||| ||||| |
|
|
| T |
18701254 |
tatctgcaaccaatttttacttatccaacgcaacatcaaaaagtctactaaattgatgacacaaaatgtatatctattaatgacgaaaaatgttccaggg |
18701155 |
T |
 |
| Q |
235 |
cctttgcttc |
244 |
Q |
| |
|
|||||||||| |
|
|
| T |
18701154 |
cctttgcttc |
18701145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University