View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_95 (Length: 237)
Name: NF3929_high_95
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_95 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 1 - 110
Target Start/End: Original strand, 44310612 - 44310721
Alignment:
| Q |
1 |
ttgttcaatgtacttatttctttgtagattgtatcactccagtccacttgcaacaacatttattcatgtctattttctctcttcaccttgagcctgcgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44310612 |
ttgttcaatgtacttatttctttgtagattgtatcactccagtccacttgcaacaacatttattcatgtctattttctctcttcaccttgagcctgcgca |
44310711 |
T |
|
| Q |
101 |
taatccaaaa |
110 |
Q |
| |
|
|||||||||| |
|
|
| T |
44310712 |
taatccaaaa |
44310721 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 156 - 221
Target Start/End: Original strand, 44310711 - 44310776
Alignment:
| Q |
156 |
ataatccaaaaattgcagtgagttgaaagctttttagttggcaatctaatatgtaggtcaatattt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
44310711 |
ataatccaaaaattgcagtgagttgaaagctttttagttgaaaatctaatatgtaagtcaacattt |
44310776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University