View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_high_98 (Length: 228)
Name: NF3929_high_98
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_high_98 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 66 - 228
Target Start/End: Original strand, 10296914 - 10297076
Alignment:
| Q |
66 |
ttttatgttcagatcatttggaaggtaagcctgaactaatgcttttgtgtaacttaatttgtatttgccactttctaatctagagaagcaagaagttact |
165 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10296914 |
ttttgtgttcagatcatttggaaggtaagcctgaactaatgcttttgtgtaacttaatttgtatttgccactttctaatctagagaagcaagaagttact |
10297013 |
T |
|
| Q |
166 |
ataggctgcacataagattttcaaagaagtttcttgctagattacaactttttgttctccatg |
228 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10297014 |
ataggctgcacataggattttcaaagaagtttcttgctagattacaactttttgttctccatg |
10297076 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 39
Target Start/End: Original strand, 10296881 - 10296919
Alignment:
| Q |
1 |
agctgattgtactctcatggatgataatacagtttttgt |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10296881 |
agctgattgtactctcatggatgataatacagcttttgt |
10296919 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 2 - 97
Target Start/End: Complemental strand, 43794831 - 43794736
Alignment:
| Q |
2 |
gctgattgtactctcatggatgataatacagtttttgtatcagattgtaaaggaaacattgctgttttatgttcagatcatttggaaggtaagcct |
97 |
Q |
| |
|
|||||||| | ||||||||||||||| || | | |||| |||||| ||||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43794831 |
gctgattgcattctcatggatgataacacggctattgtttcagatcgtaaaggaagcatagctgttttatgttcagatcatttggaaggtaagcct |
43794736 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University