View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_102 (Length: 235)
Name: NF3929_low_102
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_102 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 70; Significance: 1e-31; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 148 - 221
Target Start/End: Original strand, 10240004 - 10240077
Alignment:
| Q |
148 |
aggggtggttcttagtgtcttaggttgtgatgtttgaggtttttctttggtactgacggatgctgtgttaaatt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10240004 |
aggggtggttcttagtgtcttaggttgtgatgtttgaggtttttctttggttctgacggatgctgtgttaaatt |
10240077 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 25 - 86
Target Start/End: Original strand, 10231908 - 10231969
Alignment:
| Q |
25 |
aagtttcattgttgagaattgagatatactagagtgcctcgaaatttcgaatatagtgaata |
86 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
10231908 |
aagtttcattgttgagaattgagatatactagagtgcctcgaaatttcgaatacagtgaata |
10231969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 169 - 221
Target Start/End: Original strand, 10231242 - 10231294
Alignment:
| Q |
169 |
aggttgtgatgtttgaggtttttctttggtactgacggatgctgtgttaaatt |
221 |
Q |
| |
|
||||||||||||||| |||||||||| ||| |||||| ||||| ||||||||| |
|
|
| T |
10231242 |
aggttgtgatgtttggggtttttcttgggttctgacgaatgctatgttaaatt |
10231294 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University