View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_109 (Length: 225)
Name: NF3929_low_109
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_109 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 13 - 207
Target Start/End: Original strand, 45035449 - 45035643
Alignment:
| Q |
13 |
gcacagaacacaattgttaatacttaggagtaaattcaatcactcaaattttctggagtgttattgtcaaaagaaattattcaagagaattgaagtgtaa |
112 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45035449 |
gcacataacacaattgttaatacttaggagtaaattcaatcactcaaattttctggagtactattgtcaaaagaaattattcgagagaattgaagtgtaa |
45035548 |
T |
|
| Q |
113 |
gtttagaatatcatattggtcaagaatgtgctatatgaagaatagtctcgcaaacctcgtattataaccaacactgtacatcagactacttttac |
207 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45035549 |
gtttagaatatcatattggtcaggaatgtgctatatgaagaatagactcacaaacctcgtattataaccaacactgtacatcagactacttttac |
45035643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University