View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_114 (Length: 213)
Name: NF3929_low_114
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_114 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 54; Significance: 3e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 132 - 189
Target Start/End: Original strand, 5181671 - 5181728
Alignment:
| Q |
132 |
agcaatgaattctcagtggaaactagtcttcaacactattctctaactatgtactctc |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5181671 |
agcaatgaattctcagtggaaactagtcttcaacgctattctctaactatgtactctc |
5181728 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 36 - 85
Target Start/End: Original strand, 5181627 - 5181676
Alignment:
| Q |
36 |
attcattaagatcctaatgcataatttggttggtaaccaatatgagcaat |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5181627 |
attcattaagatcctaatgcataatttggttggtaaccaatatgagcaat |
5181676 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University