View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_32 (Length: 426)
Name: NF3929_low_32
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_32 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 173; Significance: 7e-93; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 173; E-Value: 7e-93
Query Start/End: Original strand, 18 - 198
Target Start/End: Original strand, 36716195 - 36716375
Alignment:
| Q |
18 |
aatgaatattcggaatgtttagttcattttgaatttgattaaattgaaaactggtttatctttaacctagaacttgaatttgaatttgattttactttgc |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716195 |
aatgaatattcggaatgtttagttcattttgtatttgatcaaattgaaaactggtttatctttaacctagaacttgaatttgaatttgattttactttgc |
36716294 |
T |
|
| Q |
118 |
tgtgtgtttagtgatgcttaacgcttaattgagaaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716295 |
tgtgtgtttagtgatgcttaacgcttaattgagaaccggtttatccttattcggttgttttgttcatttgtaatgcgatgc |
36716375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 106; E-Value: 7e-53
Query Start/End: Original strand, 245 - 358
Target Start/End: Original strand, 36716422 - 36716535
Alignment:
| Q |
245 |
cttagctaatattctggttaactttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa |
344 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36716422 |
cttagctaatattctggttagctttgatcataaacgttcttttgagataatttgactagaatttgatttgaattgaatttgagaaacggtttatctttaa |
36716521 |
T |
|
| Q |
345 |
taattctaacgttc |
358 |
Q |
| |
|
||| |||||||||| |
|
|
| T |
36716522 |
taaatctaacgttc |
36716535 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University