View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_59 (Length: 325)
Name: NF3929_low_59
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_59 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 7e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 1 - 84
Target Start/End: Original strand, 9499059 - 9499142
Alignment:
| Q |
1 |
tctggtttatcctttcatttcagttttctgttgttatcattgtaagagctttcagctcaccgttttccagttacataatacctt |
84 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499059 |
tctggtttatcctttcatttcagttttctgttgttatcattgtaagagctttcagctcaccgttttccagttacataatacctt |
9499142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 238 - 312
Target Start/End: Original strand, 9499308 - 9499382
Alignment:
| Q |
238 |
attatggaaagaattactacacaaaatagcccaatgctatatttatacattgcatgattttaagttggatgatgt |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9499308 |
attatggaaagaattactacacaaaatagcccaatgctatatttatacattgcatgattttaagttggatgatgt |
9499382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 18 - 81
Target Start/End: Complemental strand, 19058854 - 19058791
Alignment:
| Q |
18 |
tttcagttttctgttgttatcattgtaagagctttcagctcaccgttttccagttacataatac |
81 |
Q |
| |
|
||||| ||||||||| | ||||||||||||||||| |||||||| ||||||||||| ||||||| |
|
|
| T |
19058854 |
tttcaattttctgttttcatcattgtaagagctttgagctcaccattttccagttaaataatac |
19058791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 20 - 81
Target Start/End: Complemental strand, 47790291 - 47790230
Alignment:
| Q |
20 |
tcagttttctgttgttatcattgtaagagctttcagctcaccgttttccagttacataatac |
81 |
Q |
| |
|
||||||||||||| | ||| ||||||||||||| |||||| | ||||||||||| ||||||| |
|
|
| T |
47790291 |
tcagttttctgttttcatctttgtaagagctttgagctcatcattttccagttaaataatac |
47790230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University