View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_60 (Length: 323)
Name: NF3929_low_60
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_60 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 27 - 309
Target Start/End: Original strand, 47051566 - 47051848
Alignment:
| Q |
27 |
tcttctgactaaccattggaaatatttccacatgcaaaatctcaagctatggaaacgttgcacagagagcaacaaatgctttaagatcttgttttcgtga |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051566 |
tcttctgactaaccattggaaatatttccacatgcaaaatctcaagttgtggaaacgttgcacagagagcaacaaatgctttaagatcttgttttcgtga |
47051665 |
T |
|
| Q |
127 |
aatggagaatttaccactctttaacataggagtcttaatgcttaaggtatccaattcacactctaatgaagcaagtcttaggcaatctactaaaaacaag |
226 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47051666 |
aatggagaatttaccgctctttaacataggagtcttaatgcttaaggtatccaattcacactctaatgaagcaagtcttaggcaatctactaaaaacaag |
47051765 |
T |
|
| Q |
227 |
tttgcatccaccttgagatcattgaataccaaatcgcagcataaaaccttgagatcacataaggatgaacttactatcacagg |
309 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
47051766 |
tttgcatccaccttgagatcattgaataccaaatcgcagcataaaaccttgagatgacataaggatgaacttactatcacagg |
47051848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University