View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_68 (Length: 300)
Name: NF3929_low_68
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 172 - 284
Target Start/End: Complemental strand, 6234462 - 6234357
Alignment:
| Q |
172 |
gaaagaaacaacttaggaggagttagaggcacataaagggaaaaagtatgtcaagtaagtttattttctaaactaggaaggaggggtgtgtgtgtgagtg |
271 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
6234462 |
gaaagaaacaacttaggag---ttagaggcacataaagggaaaaagtatgtcaagtaagtttattttctaaactaggaaggaggggtg----tgtgagtg |
6234370 |
T |
 |
| Q |
272 |
atttataatgaaa |
284 |
Q |
| |
|
||||||||||||| |
|
|
| T |
6234369 |
atttataatgaaa |
6234357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University