View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_74 (Length: 282)
Name: NF3929_low_74
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_74 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 13 - 260
Target Start/End: Original strand, 31100455 - 31100703
Alignment:
| Q |
13 |
attctctatcaaagatttagggcacttgtactactttcttggtgaagaggtcatccctacagctagca-caggtttatttcttagccaacataaatatat |
111 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||| |
|
|
| T |
31100455 |
attctctatcaacgatttagggcacttgtactactttcttggtgaagaggtcatccctacagctagcaacatgtttatttcttagccaacataaatatat |
31100554 |
T |
 |
| Q |
112 |
tgaagaccttcttgaaggaactgaaatgttagaagccaagcttgttcttattccattgtacaaagatggcgacttacaaagttctgatgccaccttctat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31100555 |
tgaagaccttcttgaaggaactgaaatgttagaagccaagcttgttcttattccattgtacaaagatgacgacttacaaagttctgatgccaccttctat |
31100654 |
T |
 |
| Q |
212 |
cgcaaaatcattggcagtctacaatatttaactatgactcggcctgata |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31100655 |
cgcaaaatcattggcagtctacaatatttaactatgactcggcctgata |
31100703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University