View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_78 (Length: 261)
Name: NF3929_low_78
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_78 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 18 - 256
Target Start/End: Original strand, 687765 - 687995
Alignment:
| Q |
18 |
agcaggagttgttgtcgtccctttcatcaactagttctgatttgctgcttttaagaatatgagttcgagttataaccaaaatgacaatcatttgttaaaa |
117 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||| || |
|
|
| T |
687765 |
agcaggagttgttgtcatccctttcatcaactagttctcatttgct---tttaagaatatgagttcgagttataaccaaaacgacaatcatttgttataa |
687861 |
T |
 |
| Q |
118 |
tcaaaacaaaactagtcttttcctaaaaaattaagatgggttcgtaaggcgttcaaaaataacgtattaaactgtgcaaaaattcaatttgatgcagatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
687862 |
tcaaaacaaaactagtcttttcctaaaatattaagatgg----gtaaggcgttc-aaaataacatattaaactgtgcaaaaattcaatttgatgcagatc |
687956 |
T |
 |
| Q |
218 |
agaaaatatataagcaacaaacaagcttccatttcagtg |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
687957 |
agaaaatatataagcaacaaacaagcttccatttcagtg |
687995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University