View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_80 (Length: 258)
Name: NF3929_low_80
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_80 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 230
Target Start/End: Original strand, 27418593 - 27418812
Alignment:
| Q |
11 |
cacagaacttcaactcgtctcgctggaaattgcggattcaacgggatggcacagcagacttggcccgatttttcactcatacttgagtgttttctcttag |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27418593 |
cacagaacttcaactcgtctcgctggaaattgcggattcaacgggatggcacagcagacttggcccgatttttcactcatacttgagtgttttctcttag |
27418692 |
T |
|
| Q |
111 |
tgttttatcaataaatttacgcaataaacttatctttttaattttggaattaattcatataattgaacggattgtgatactttaatactgttctatatat |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27418693 |
tgttttatcaataaatttacgcaataaacttatctttttaattttggaattaattcatataattgaacggattgtgatactttaatactgttctatatat |
27418792 |
T |
|
| Q |
211 |
tagaatttcttgagatctgg |
230 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
27418793 |
tagaatttcttgagatctgg |
27418812 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University