View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF3929_low_94 (Length: 245)
Name: NF3929_low_94
Description: NF3929
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF3929_low_94 |
 |  |
|
| [»] scaffold0086 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0086 (Bit Score: 121; Significance: 4e-62; HSPs: 1)
Name: scaffold0086
Description:
Target: scaffold0086; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 40 - 223
Target Start/End: Original strand, 28381 - 28565
Alignment:
| Q |
40 |
aaaagcctcaagaaatcagccatatcagctatatccattataaatacaataaaacaagaaggtaaaaagcaaaatactagatgattctatcaccaa-ggc |
138 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||| ||||| || |||||||||||||||||||||||||||||| | |
|
|
| T |
28381 |
aaaagccaaaagaaatcagccatatcagctatatccattataaataccataaaaccagaagatacgaagcaaaatactagatgattctatcaccaatgtt |
28480 |
T |
 |
| Q |
139 |
tataactatctttaaaagcatcatcttttccacaattaccaaaaagtctagacaaatatcggatttagaagtagaaatgattctg |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||| |||| ||||||||||||| |
|
|
| T |
28481 |
tataactatctttaaaagcatcatcttttccacaattaccaaaaagcctaaacaaatattggatttggaagcagaaatgattctg |
28565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University